Virtual Labs

a: gaaggggggacagataattggggtgaagtcgtaacaaggtagccgtatcggaagggatgg b: cctaaagagtaacggaggcgcccaaagggtccctcagaatggatggaaatcattcgcagag c: gaaggtgggacagataattggggtgaagtcgtaacaaggtagccgtatcggaaggtgcgg) d: gaaggggggacagataattggggtgaagtcgtaacaaggtagccgtatcggaaggtgcgg

2.High GC content relates to

a: Low melting point b: High melting point c: High boiling point d: Low boiling point

3.The bond that exist between the bases of DNA

a: Phosphodiester bond b: Hydrogen bond c: Peptide bond d: Disulphide bond

4. The package used in R programming to find GC content of given DNA sequence:

a: SequinR b: Biostring c: ggplot d: shiny

5. GC ratio analysis is applicable in:

a: Understanding the statistical significance of a DNA sequence b: Ecological and evolutionary significance of species c: Identifying annealing temperature of a DNA sequence d: All the above

Community Links Sakshat Portal Outreach Portal FAQ: Virtual Labs

AGPL 3.0 & Creative Commons (CC BY-NC-SA 4.0)